n-3 Fatty Acids Specifically Modulate Catabolic Factors Involved in Articular Cartilage Degradation

Findings provide evidence that n-3 fatty acid supplementation can specifically affect regulatory mechanisms involved in chondrocyte gene transcription and thus further advocate a beneficial role for dietary fish oil supplementation in alleviation of several of the physiological parameters that cause and propogate arthritic disease.

Abstract

This study describes specific molecular mechanisms by which supplementation with n-3 fatty acids (i.e. those present in fish oils) can modulate the expression and activity of degradative and inflammatory factors that cause cartilage destruction during arthritis. Our data show that incorporation of n-3 fatty acids (but not other polyunsaturated or saturated fatty acids) into articular cartilage chondrocyte membranes results in a dose-dependent reduction in: (i) the expression and activity of proteoglycan degrading enzymes (aggrecanases) and (ii) the expression of inflammation-inducible cytokines (interleukin (IL)-1α and tumor necrosis factor (TNF)-α) and cyclooxygenase (COX-2), but not the constitutively expressed cyclooxygenase COX-1. These findings provide evidence thatn-3 fatty acid supplementation can specifically affect regulatory mechanisms involved in chondrocyte gene transcription and thus further advocate a beneficial role for dietary fish oil supplementation in alleviation of several of the physiological parameters that cause and propogate arthritic disease. This study describes specific molecular mechanisms by which supplementation with n-3 fatty acids (i.e. those present in fish oils) can modulate the expression and activity of degradative and inflammatory factors that cause cartilage destruction during arthritis. Our data show that incorporation of n-3 fatty acids (but not other polyunsaturated or saturated fatty acids) into articular cartilage chondrocyte membranes results in a dose-dependent reduction in: (i) the expression and activity of proteoglycan degrading enzymes (aggrecanases) and (ii) the expression of inflammation-inducible cytokines (interleukin (IL)-1α and tumor necrosis factor (TNF)-α) and cyclooxygenase (COX-2), but not the constitutively expressed cyclooxygenase COX-1. These findings provide evidence thatn-3 fatty acid supplementation can specifically affect regulatory mechanisms involved in chondrocyte gene transcription and thus further advocate a beneficial role for dietary fish oil supplementation in alleviation of several of the physiological parameters that cause and propogate arthritic disease. cyclooxygenase interleukin tumor necrosis factor reverse transcription-polymerase chain reaction Noninvasive, pharmaceutical-based therapies for the treatment of arthritic diseases are primarily limited to oral administration of nonsteroidal antiinflammatory drugs, which inhibit cyclooxygenase (COX)1-mediated production of inflammatory eicosanoids such as prostaglandins (1.Vane J.R. Bakhle Y.S. Botting R.M. Annu. Rev. Pharmacol. Toxicol. 1998; 38: 97-120Crossref PubMed Scopus (2584) Google Scholar, 2.Smith W.L. Garavito R.M. Dewitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1837) Google Scholar). Parenthetically, clinical studies on dietary supplementation withn-3 (omega-3) fatty acids (the principle long chain polyunsaturated fatty acids found in fish oils) have also demonstrated modulation of inflammatory symptoms involved in the pathogenesis of arthritis (3.Volker D. Garg M. J. Clin. Biochem. Nutr. 1996; 20: 83-87Crossref Scopus (28) Google Scholar, 4.Kremer J.M. Lipids. 1996; 31: S243Crossref PubMed Google Scholar, 5.Ariza-Ariza R. Mestanza-Peralta M. Cardiel M.H. Semin. Arthritis Rheum. 1998; 27: 366-370Crossref PubMed Scopus (74) Google Scholar). Such epidemiological observations have been largely anecdotal, because they did not investigate the molecular mechanisms whereby dietary n-3 fatty acid supplementation might affect the metabolism of cells within articular joint tissues and thereby provide relief to arthritic symptoms. Significantly, however, dietary supplementation with n-3 fatty acids elicits antiinflammatory effects in neutrophils and monocytes by inhibiting the 5-lipoxygenase pathway responsible for metabolism of arachidonic acid to leukotrienes (6.Lee T.H. Hoover R.L. Williams J.D. Sperling R.I. Ravalese J. Spur B.W. Robinson D.R. Corey E.J. Lewis R.A. Austen K.F. N. Engl. J. Med. 1985; 312: 1217-1224Crossref PubMed Scopus (1119) Google Scholar). Furthermore, n-3 fatty acid supplementation can also suppress phospholipase C-mediated signal transduction (7.Sperling R.I. Benincaso A.I. Knoell C.T. Larkin J.K. Austen K.F. Robinson D.R. J. Clin. Invest. 1993; 91: 651-660Crossref PubMed Scopus (297) Google Scholar), thus demonstrating additional molecular mechanisms whereby n-3 fatty acids can specifically affect cell metabolism. One of the key pathological features common to degenerative joint diseases (arthritis) is the loss of cartilage proteoglycan (aggrecan), which precedes subsequent cartilage erosion. Catabolism of aggrecan is mediated by the proteolytic activity of aggrecanases (8.Sandy J.D. Flannery C.R. Neame P.J. Lohmander L.S. J. Clin. Invest. 1992; 89: 1512-1516Crossref PubMed Scopus (386) Google Scholar, 9.Hughes C.E. Little C.B. Büttner F.H. Bartnik E. Caterson B. J. Biol. Chem. 1998; 273: 30576-30582Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 10.Arner E.C. Pratta M.A. Trzaskos J.M. Decicco C.P. Tortorella M.D. J. Biol. Chem. 1999; 274: 6594-6601Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 11.Little C.B. Flannery C.R. Hughes C.E. Mort J.S. Roughley P.J. Dent C. Caterson B. Biochem. J. 1999; 344: 61-68Crossref PubMed Scopus (168) Google Scholar), two isoforms of which have recently been purified and cloned (12.Tortorella M.D. Burn T.C. Pratta M.A. Abbaszade I. Hollis J.M. Liu R. Rosenfeld S.A. Copeland R.A. Decicco C.P. Wynn R. Rockwell A. Yang F. Duke J.L. Solomon K. George H. Bruckner R. Nagase H. Itoh Y. Ellis D.M. Ross H. Wiswall B.H. Murphy K. Hillman Jr., M.C. Hollis G.F. Newton R.C. Magolda R.L. Trzaskos J.M. Arner E.C. Science. 1999; 284: 1664-1666Crossref PubMed Scopus (618) Google Scholar, 13.Abbaszade I. Liu R.-Q. Yang F. Rosenfeld S.A. Ross O.H. Link J.R. Ellis D.M. Tortorella M.D. Pratta M.A. Hollis J.M. Wynn R. Duke J.L. George H.J. Hillman Jr., M.C. Murphy K. Wiswall B.H. Copeland R.A. Decicco C.P. Bruckner R. Nagase H. Itoh Y. Newton R.C. Magolda R.L. Trzaskos J.M. Hollis G.F. Arner E.C. Burn T.C. J. Biol. Chem. 1999; 274: 23443-23450Abstract Full Text Full Text PDF PubMed Scopus (444) Google Scholar). Aggrecanase activity is up-regulated by cartilage exposure to pro-inflammatory cytokines such as IL-1 and TNF-α, and model cartilage explant and chondrocyte culture systems stimulated with IL-1 or TNF-α mimic the degradative processes involving aggrecan catabolism which occur during arthritis (14.Sandy J.D. Neame P.J. Boynton R.E. Flannery C.R. J. Biol. Chem. 1991; 266: 8683-8685Abstract Full Text PDF PubMed Google Scholar, 15.Aydelotte M.B. Raiss R.X. Caterson B. Kuettner K.E. Connect. Tissue Res. 1992; 28: 143-159Crossref PubMed Scopus (56) Google Scholar, 16.Ilic M.Z. Handley C.J. Robinson H.C. Mok M.T. Arch. Biochem. Biophys. 1992; 294: 115-122Crossref PubMed Scopus (163) Google Scholar, 17.Loulakis P. Shrikhande A. Davis G. Maniglia C.A. Biochem. J. 1992; 284: 589-593Crossref PubMed Scopus (122) Google Scholar, 18.Arner E.C. Hughes C.E. Decicco C.P. Caterson B. Tortorella M.D. Osteoarthritis Cartilage. 1998; 6: 214-228Abstract Full Text PDF PubMed Scopus (126) Google Scholar). In addition, exposure to these inflammatory mediators propogates the autocrine synthesis of cartilage cytokines, which contribute to the chronic progression of arthritis. Furthermore, cytokine-induced degradative activities in synovial joint tissues can be potentiated via the biosynthesis of inflammatory eicosanoids by the cyclooxygenases COX-1 and COX-2 (1.Vane J.R. Bakhle Y.S. Botting R.M. Annu. Rev. Pharmacol. Toxicol. 1998; 38: 97-120Crossref PubMed Scopus (2584) Google Scholar, 2.Smith W.L. Garavito R.M. Dewitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1837) Google Scholar). COX-1, which is constitutively expressed in most tissues, is responsible for key aspects of eicosanoid biosynthesis, which are important in maintaining homeostasis during normal cellular metabolism (19.Smith W.L. Dewitt D.L. Adv. Immunol. 1996; 62: 167-170Crossref PubMed Google Scholar). Conversely, COX-2 expression and activity is induced during inflammation, and it is this enzyme that is selectively involved in inflammatory aspects of arthritic disease (20.Anderson G.D. Hauser S.D. McGarity K.L. Bremer M.E. Isakson P.C. Gregory S.A. J. Clin. Invest. 1996; 97: 2672-2679Crossref PubMed Scopus (532) Google Scholar, 21.Crofford L.J. Wilder R.L. Ristimaki A.P. Sano H. Remmers E.F. Epps H.R. Hla T. J. Clin. Invest. 1994; 93: 1095-1101Crossref PubMed Scopus (663) Google Scholar). Consequently, modulation of COX-2 activity has been a major target of pharmaceutical companies for intervention in the pathogenesis of arthritis (22.Blanco F.J. Guitian R. Moreno J. de Toro F.J. Galdo F. J. Rheumatol. 1999; 26: 1366-1373PubMed Google Scholar). To determine a molecular basis for potential therapeutic properties associated with dietary intake of fish oils, we investigated the effects of different classes of fatty acids on the expression and activity of cartilage aggrecanases, cytokines (IL-1α and TNF-α) and cyclooxygenases (COX-1 and COX-2). The results of these in vitro studies reveal that exposure of articular chondrocytes ton-3 fatty acids can specifically modulate, at the level of gene transcription, key factors involved in articular cartilage degradation. Bovine articular cartilage was obtained from the metacarpo- and metatarsophalangeal joints of 7-day-old calves. Cartilage tissue slices were dissected under sterile conditions and subjected to standard Pronase and collagenase digestion to isolate the chondrocytes as described previously (9.Hughes C.E. Little C.B. Büttner F.H. Bartnik E. Caterson B. J. Biol. Chem. 1998; 273: 30576-30582Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Monolayer cultures were established in 60-mm diameter culture dishes by plating 1 ml/dish of a suspension of 6 × 106 chondrocytes/ml of DMEM (∼2 × 105 cells/cm2). Cultures were maintained for 8 h in the absence or presence (10–100 μg/ml) of polyunsaturated n-3 fatty acids (α18:3 linolenate, 2Approved nomenclature (trivial names) for fatty acids is as recommended by the IUPAC-IUB. 20:5 eicosapentaenoate or 22:6 docosahexaenoate), a polyunsaturatedn-6 fatty acid (18:2 linoleate), a saturated fatty acid (16:0 palmitate), or a monounsaturated fatty acid (18:1 oleate). All fatty acids were minimum 99% purity from Sigma-Aldrich Co., Poole, United Kingdom. Prior to their addition to culture media, fatty acids were incubated as described (23.Sicard B. Lagarde M. Thromb. Haemostasis. 1985; 53: 264-267Crossref PubMed Scopus (14) Google Scholar) for 16 h at 37 °C in Tyrode-HEPES buffer (20 mm HEPES, 140 mm NaCl, 4.5 mm KCl, 1 mm MgCl2, 2.5 mm CaCl2, 11 mm glucose, pH 7.4) containing 3.5 mg/ml fatty acid-free bovine albumin (Fraction V, Sigma-Aldrich Co.) at a ratio of 3:1 fatty acid:albumin. The culture medium was removed and then replaced with fresh medium (without fatty acid) supplemented with or without 10 ng/ml IL-1α. Chondrocyte cell layers were harvested using a rubber policeman and washed three times in phosphate-buffered saline by centrifugation for 10 min at 1000 × g. The cells were resuspended in 1 ml deionized water and sonicated for 30 min in an ultrasonic water bath. Once complete lysis of the cells had been achieved, extraction of the lipids was performed (24.Garbus J. DeLuca H.F. Loomans M.E. Strong F.M. J. Biol. Chem. 1963; 238: 59-63Abstract Full Text PDF PubMed Google Scholar). Briefly, 1 ml of cell lysate was mixed with 3.75 ml of chloroform/methanol (1:2 v/v) and incubated for 30 min at 20 °C. Following the addition of 1.25 ml of chloroform and 1.25 ml of Garbus solution (2 m KCl, 0.5 m KPO4, pH 7.4), the chloroform phase of all mixtures was dried down in a stream of nitrogen. Generation of fatty acid methyl esters was achieved by addition of H2SO4 (2.5%) in anhydrous methanol (1%). As an internal standard an appropriate quantity of pentadecaenoic acid (15:0) was added. After sealing, the tubes were heated for 2 h at 70 °C. The tubes were then cooled and 2.5 ml of 5% NaCl was added. The methyl esters were extracted three times with 3 ml of petroleum ether, dried down in a stream of nitrogen, and then redissolved in chromatographically pure petroleum ether. The methyl esters were analyzed using gas chromatography, with the yields of fatty acid being calculated from the known amount of internal standard. Cellular DNA content of all chondrocyte cultures was measured using the Hoechst 33258 dye DNA assay (25.Kim Y.-J. Sah R.L.Y. Doong J.-Y.H. Grodzinsky A.J. Anal. Biochem. 1988; 174: 168-176Crossref PubMed Scopus (1195) Google Scholar). Proteoglycan synthesis was measured by radiolabeling cultures for 96 h with [35S]sulfuric acid (20 μCi/ml). Unincorporated radiolabel was removed from the culture media and cell layer extracts using a Sephadex G-50 column (Amersham Pharmacia Biotech) and total counts/min in the void volume measured. The concentration of lactate in culture media was measured using a commercial lactate assay kit (Sigma-Aldrich Co.). The expression of mRNAs for two genes which are characteristic of the chondrocyte phenotype (i.e. aggrecan and collagen type II) was assessed by RT-PCR as described below. To detect the occurrence of aggrecanase or matrix metalloproteinase activity in the monolayer cultures, portions of conditioned media containing an equivalent quantity of proteoglycan metabolites (measured by dimethylmethylene blue assay (26.Farndale R.W. Buttle D.J Barret A.J. Biochim. Biophys. Acta. 1986; 883: 173-177Crossref PubMed Scopus (2875) Google Scholar)) were analyzed by SDS-polyacrylamide gel electrophoresis and Western blotting as described previously (9.Hughes C.E. Little C.B. Büttner F.H. Bartnik E. Caterson B. J. Biol. Chem. 1998; 273: 30576-30582Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Briefly, after deglycosylation with chondroitinase ABC (Sigma-Aldrich Co.), keratanase and keratanase II (Seikagaku/AMS Biotechnology, Abingdon, UK), aggrecan fragments were separated on 4–12% gradient gels (Novex, Frankfurt, Germany) and electrophoretically transferred to nitrocellulose. Membranes were then probed using monoclonal antibody BC-3 (which specifically recognizes the aggrecanase-generated neoepitope N-terminal sequence 374ARGSV … on aggrecan metabolites) or monoclonal antibody BC-14 (which specifically recognizes the matrix metalloproteinase-generated neoepitope N-terminal sequence 342FFGVG … on aggrecan metabolites) (9.Hughes C.E. Little C.B. Büttner F.H. Bartnik E. Caterson B. J. Biol. Chem. 1998; 273: 30576-30582Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Bovine chondrocyte monolayer cultures were extracted by direct addition of Tri-Reagent (Sigma-Aldrich Co.). Following the addition of chloroform (0.2 ml/1 ml of Tri-Reagent) and centrifugation for 20 min at ∼16,000 ×g, total RNA from the aqueous phase of all extracts was isolated using Rneasy mini-columns and reagents (Qiagen, Crawley, Ltd., Crawley, UK). Because spectrophotometric analyses revealed a reasonable, but relatively low, yield of total RNA (approximately 20 μg/60-mm culture dish), we utilized RT-PCR methods to examine chondrocyte gene transcription. First strand cDNA was synthesized by reverse transcription and PCR amplification was performed as described (27.Flannery C.R. Little C.B. Caterson B. Hughes C.E. Matrix Biol. 1999; 18: 225-237Crossref PubMed Scopus (102) Google Scholar) using oligonucleotide primers corresponding to cDNA sequences for aggrecan (CGCTACGACGCCATCTGCTAC and GCCTGCTGTGCCTCCTCAAA; GenBankTM accession number M55172), collagen II-αI (TGCCTGGTGCTCCTGGTCTGA and CTTCTCCCTTCTCGCCGTTAG; GenBankTM accession number X16711), aggrecanase-1 (ACCACTTTGACACAGCCATTC and ACCCCCACAGGTCCGAGAGCA; GenBankTMaccession number AF148213), aggrecanase-2 (TGTGCTGTGATTGAAGACGAT and GACTGCAGGAGCGGTAGATGG; GenBankTM accession numberAF142099), COX-1 (GCCCAACACTTCACCCATCAG and CCAGGAAGCAGCCCAAACACT; GenBankTM accession number AF004943), COX-2 (GCTCTTCCTCCTGTGCCTGAT and CATGGTTCTTTCCCTTAGTGA; GenBankTMaccession number AF004944), IL-1α (AAGGAGAATGTGGTGATGGTG and CAGAAGAAGAGGAGGTTGGTC; GenBankTM accession numberM37210), TNF-α (CTCAAGCCTCAAGTAACAAGC and GCAATGATCCCAAAGTAGACC; GenBankTM accession number Z48808), and GAPDH (TGGTATCGTGGAAGGACTCAT and GTGGGTGTCGCTGTTGAAGTC; GenBankTM accession number X01677). PCR products were separated on 3% agarose gels, stained with ethidium bromide, and their nucleotide sequences verified using an Applied Biosystems 310 Genetic Analyzer. The cDNA sequences obtained for bovine aggrecanase-1 and aggrecanase-2 have been deposited to GenBankTM under accession numbers AF192770 and AF192771. In this study, articular cartilage chondrocytes were exposed in culture to fatty acids at concentrations which cover the typical range (50–70 μg/ml) for free fatty acid levels in human plasma (28.Bang H.O. Dyerberg J. Nielsen A.B. Lancet. 1971; 1: PubMed Scopus Google Scholar). The results for of the content of chondrocytes supplemented without or with a polyunsaturated n-3 (α18:3 or a saturated (16:0 fatty acid are in I. to the n-3 fatty acid the of the chondrocyte with major in the supplemented fatty acid with a reduction in other polyunsaturated fatty supplementation with the level of this fatty acid in the chondrocyte at the of polyunsaturated fatty acid cultures, with or without fatty acid were then for a further 96 h in the absence or presence of IL-1α. Proteoglycan as measured by was in chondrocyte cultures with IL-1α with as has been previously Biochem. J. 1985; PubMed Scopus Google Scholar). addition of fatty acids to the cultures had on these in proteoglycan synthesis or in cell DNA content or in levels of lactate into the medium not thus demonstrating that fatty acid supplementation was not to the Furthermore, expression of mRNAs for aggrecan and collagen type II of the chondrocyte phenotype in the cultures not acid of chondrocyte membranes from cultures with or without n-3 polyunsaturated or saturated fatty of total fatty acids in acid fatty (α18:3 fatty (16:0 fatty fatty fatty fatty fatty fatty fatty fatty are the for cells harvested from two different fatty fatty fatty in a are the for cells harvested from two different The of fatty acid supplementation on chondrocyte aggrecanase activity was then investigated was evidence for aggrecanase activity in conditioned medium from cultures supplemented with n-3 1 and or saturated fatty acids 1 1 and to as (8.Sandy J.D. Flannery C.R. Neame P.J. Lohmander L.S. J. Clin. Invest. 1992; 89: 1512-1516Crossref PubMed Scopus (386) Google Scholar), did aggrecanase activity in these conditioned media and addition of fatty acid this aggrecanase activity in a dose-dependent 1 In supplementation with had on aggrecanase activity 1 In evidence for matrix aggrecan was for cultures maintained in the absence or presence of n-3 or saturated fatty acids not In with the loss of proteolytic activity in chondrocyte conditioned was also a in the levels of for aggrecanase-1 and aggrecanase-2 in to n-3 fatty acid supplementation was in but not cultures, for aggrecanase-2 was in the presence and absence of IL-1 and 1 and addition of fatty acid a in aggrecanase-1 and aggrecanase-2 levels 2 In cultures supplemented with expressed aggrecanase-1 and aggrecanase-2 mRNAs at all concentrations of fatty acid 2 The addition of the for fatty acid supplementation acid-free had on aggrecanase-1 or expression in the or cultures not of GAPDH was to the amount of present in all of fatty acid supplementation on expression of chondrocyte aggrecanase-1 and aggrecanase-2 Cultures were supplemented with or without of n-3 or and with or without RNA was extracted and by The of PCR products to the of DNA is to the of the of supplementation with n-3 fatty acids other fatty acids on COX-1 and COX-2 expression and on the expression of IL-1α and TNF-α mRNAs in chondrocyte cultures exposed to IL-1 Chondrocyte COX-1 was present in all culture with or without fatty acid supplementation 3 chondrocyte COX-2 expression was in but not cultures 3 1 Significantly, COX-2 expression in cultures was by n-3 fatty acid (α18:3 supplementation 3 In addition of a saturated fatty acid (16:0 had such on COX-2 expression not of expression revealed that the mRNAs for IL-1α and TNF-α were in cultures 3 but these were exposure to IL-1α expression of chondrocyte IL-1α and TNF-α mRNAs was in n-3 fatty cultures 3 but not in cultures supplemented with saturated fatty acids not results to those in 3 were obtained two other n-3 fatty acids found in fish acid and acid) were to the culture and effects were an fatty acid acid) or a monounsaturated fatty acid acid) were supplemented not These results that the effects on the expression of chondrocyte aggrecanases, and autocrine cytokines are specific to supplementation withn-3 (omega-3) fatty these data provide on the and molecular mechanisms whereby dietary fish oil supplementation can inflammatory and degradative aspects of articular joint disease and thus modulate disease The of dietary polyunsaturated fatty acids is known to affect inflammatory H. T. Res. 1996; PubMed Scopus Google Scholar). fatty acids of the such as are involved in the production of inflammatory eicosanoids J.L. Med. Res. Rev. 1996; PubMed Scopus Google Scholar), and n-3 polyunsaturated fatty acids can with this for the or by eicosanoids with different activities J.L. and Scholar). the other evidence thatn-3 fatty acids can gene expression via of transcription factors such as or by expression levels of regulatory M. J. Biol. Chem. 1999; 274: Full Text Full Text PDF PubMed Scopus Google Scholar). such mechanisms to be investigated in findings thatn-3 fatty acid supplementation can specifically affect molecular mechanisms that the expression of factors involved in articular cartilage and thus further advocate a beneficial role for dietary fish in alleviation of several of the physiological parameters that cause and propogate arthritic disease.