Agrobacterium tumefaciens virE operon encodes a single-stranded DNA-binding protein.
Proceedings of the National Academy of SciencesPublished 1 May 1988Open access
Anath Bandhu Das
Citations101
Generate an AI Snapshot to get a quick, structured summary of this paper.
Study Snapshot
ObjectiveStudy objective
MethodsResearch methodology
PopulationPopulation studied
Sample sizeSample sizes
OutcomesStudy outcomes here
ResultsStudy results comes here
LimitationsResearch study limitations comes here
A concise AI-generated summary of the paper will appear here once you click Generate AI Snapshot.
TL;DR
DNA-protein binding experiments showed that a strong single-stranded DNA-binding activity was present in protein fractions containing the virE2 gene product, and protein blotting studies indicated that the ssDNA- binding activity was associated with the 68-kDa virE 2 polypeptide.
Abstract
The virulence (vir) genes of Agrobacterium tumefaciens Ti plasmid are essential for transformation of plant cells. Overproduction of a virE-encoded gene product in Escherichia coli was achieved by construction of an operon fusion with the E. coli tryptophan (trp) operon. The virE2 gene product in E. coli partitioned into the insoluble membrane fraction. The protein was solubilized by treatment with 4 M urea at 0 degree C. DNA-protein binding experiments showed that a strong single-stranded (ss) DNA-binding activity was present in protein fractions containing the virE2 gene product. The binding was highly specific with little or no binding observed with either double-stranded DNA or ssRNA. No significant binding to Ti plasmid DNA sequences was observed. Protein blotting studies indicated that the ssDNA-binding activity was associated with the 68-kDa virE2 polypeptide.
Keywords
Biochemistry, Genetics and Molecular Biology
NatureCleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4
251,640 Citations1970Ulrich K. Laemmli
Using an improved method of gel electrophoresis, many hitherto unknown proteins have been found in bacteriophage T4 and some of these have been identified with specific gene products.
Analytical BiochemistryA Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding
225,378 Citations1976Mark A. Bradford
Proceedings of the National Academy of SciencesElectrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
53,843 Citations1979Harry Towbin, T. Staehelin +1 more
A method has been devised for the electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets that results in quantitative transfer of ribosomal proteins from gels containing urea.
Cellular Physiology and BiochemistryShort-Term Effects of Nose-Only Cigarette Smoke Exposure on Glutathione Redox Homeostasis, Cytochrome P450 1A1/2 and Respiratory Enzyme Activities in Mice Tissues
47,283 Citations2013Haider Raza, Annie John +1 more
The results suggest that even short term exposure of cigarette smoke have adverse effects on mitochondrial functions and redox homeostasis in tissues which may progress to further complications associated with chronic smoking.
Analytical BiochemistryA technique for radiolabeling DNA restriction endonuclease fragments to high specific activity
25,157 Citations1983Andrew P. Feinberg, Bert Vogelstein
A technique for conveniently radiolabeling DNA restriction endonuclease fragments to high specific activity is described, and these "oligolabeled" DNA fragments serve as efficient probes in filter hybridization experiments.
GeneImproved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors
15,166 Citations1985Celeste Yanisch-Perron, Jeffrey Vieira +1 more
New Escherichia coli host strains have been constructed for the E. coli bacteriophage M13 and the high-copy-number pUC-plasmid cloning vectors and mutations introduced into these strains improve cloning of unmodified DNA and of repetitive sequences.
Biochemical JournalThe purification of eukaryotic polypeptides synthesized in <i>Escherichia coli</i>
839 Citations1986Fiona A. O. Marston
From the increasing number of reports of eukaryotic polypeptide synthesis in E. coli it is clear that the mode of expression affects not only the efficiency of production, but the nature of the polypePTide product itself.
Nucleic Acids ResearchThe detection of DNA-binding proteins by protein blotting
731 Citations1980Brian C. Bowen, Jay A. Steinberg +2 more
Evidence is presented that specific protein-DNA interactions may be detected by this technique; under appropriate conditions, the lac repressor binds only to DNA containing the lac operator.
Annual Review of BiochemistrySINGLE-STRANDED DNA BINDING PROTEINS REQUIRED FOR DNA REPLICATION
561 Citations1986John W. Chase, Kenneth R. Williams
Journal of Biological ChemistryAssembly of the mitochondrial membrane system. CBP6, a yeast nuclear gene necessary for synthesis of cytochrome b.
456 Citations1985Carol L. Dieckmann, Alexander Tzagoloff
A new gene function involved in the expression of mitochondrial cytochrome b is described, which is confirmed by analysis of the mitochondrial translation products in E158, a respiratory deficient strain of Saccharomyces cerevisiae with a recessive mutation in nuclear DNA.
Journal of BacteriologyAgrobacterium tumefaciens mutants affected in crown gall tumorigenesis and octopine catabolism
428 Citations1980David Garfinkel, Eugene W. Nester
Mutants of Agrobacterium tumefaciens which affect virulence or the ability to catabolize octopine were isolated after Tn5-induced mutagenesis, and three mutants contained insertions in the T-deoxyribonucleic acid.
The EMBO JournalThe genetic and transcriptional organization of the vir region of the A6 Ti plasmid of Agrobacterium tumefaciens.
421 Citations1986Scott E. Stachel, E W Nester
Results show that the pTiA6 vir region contains six distinct vir complementation groups: virA, virB, virC, virD, virE and virG, which are probably polycistronic and also contains plant‐inducible loci which are non‐essential for virulence.
Proceedings of the National Academy of SciencesA plant cell factor induces <i>Agrobacterium tumefaciens vir</i> gene expression
329 Citations1986Scott E. Stachel, Eugene W. Nester +1 more
It is shown that vir gene expression is specifically induced by a small (<1000 Da) diffusible plant cell metabolite present in limiting quantities in the exudates of a variety of plant cell cultures.
Journal of BacteriologyIdentification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region
290 Citations1985Carl J. Douglas, Roberto J. Staneloni +2 more
A cosmid clone of the chromosomal virulence region containing a lac fusion in the extreme 3' portion of the 5-kilobase locus was used to demonstrate that expression of this region is dependent on the presence of sequences in the 5' portions of the locus, confirming its operon-like nature.
Proceedings of the National Academy of SciencesUse of a protein-blotting procedure and a specific DNA probe to identify nuclear proteins that recognize the promoter region of the transferrin receptor gene.
288 Citations1985W. Keith Miskimins, M P Roberts +2 more
The technique utilizes electrophoretic transfer of NaDodSO4/PAGE-fractionated proteins onto nitrocellulose filters to identify proteins that bind specifically to the promoter region of the transferrin receptor gene.
CellRight 25 by terminus sequence of the nopaline t-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome
288 Citations1984Kan Wang, Luís Herrera‐Estrella +2 more
The results indicate that the 25 bp T- DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action.
Proceedings of the National Academy of SciencesShort direct repeats flank the T-DNA on a nopaline Ti plasmid
255 Citations1982Narendra Singh Yadav, Jos Vanderleyden +3 more
The physical structure of T-DNA differs from that of known prokaryotic and eukaryotic transposable elements but bears a structural resemblance to the prophage of bacteriophage lambda.
CellThe virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease
251 Citations1986Martin F. Yanofsky, Sandra Porter +4 more
It is reported here that the virD operon encodes a site-specific endonuclease that cleaves at a unique site within each of the 24 bp direct repeats that flank the T-DNA.
Journal of BacteriologyRegions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of gram-negative bacteria
219 Citations1985Thomas J. Schmidhauser, Donald R. Helinski
The broad-host-range maintenance requirements of plasmid RK2, therefore, are encoded by multiple functions, and the requirement for one or more of these functions varies among gram-negative bacterial species.
Journal of BacteriologyCharacterization of Tn904 insertions in octopine Ti plasmid mutants of Agrobacterium tumefaciens
174 Citations1980G. Ooms, P. M. Klapwijk +2 more
The Tn904 inserts did not affect oncogenicity, tumor morphology, bacterial transfer functions, octopine catabolism functions, or vital parts of the Ti plasmid, such as the origin of replication.
PubMedTumor induction by Agrobacterium tumefaciens: analysis of the boundaries of T-DNA.
170 Citations1982Patricia Zambryski, Ann Depicker +2 more
Analysis of the DNA sequences of the plant border clones compared with the corresponding sequences ofThe Ti plasmid suggests that the mechanism of transferred DNA integration and subsequent stabilization is precise at the right border and imprecise on the left.
Journal of BacteriologyProcessing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear, single-stranded T-DNA
157 Citations1987Lisa M. Albright, M. Yanofsky +3 more
It is proposed that structural changes induced in Agrobacterium T-DNA by cocultivation with plant cells occur by a mechanism similar to DNA processing during conjugative DNA transfer between bacteria.
Proceedings of the National Academy of SciencesMobilization of T-DNA from Agrobacterium to plant cells involves a protein that binds single-stranded DNA.
127 Citations1987Christine Gietl, Zdena Koukolíková‐Nicola +1 more
Crude protein extracts of induced and uninduced octopine wild-type strain of Agrobacterium tumefaciens, as well as several mutants of the virulence loci virA, -B, -G, -D, and -E, were probed with single- and double-stranded synthetic oligodeoxynucleotides of different sequence and length in an electrophoretic retardation assay.
CellDNA from the A6S/2 crown gall tumor contains scrambled Ti-plasmid sequences near its junctions with plant DNA
123 Citations1982Robert B. Simpson, Patrick J. O’Hara +5 more
Data suggesting that the 23 bp to the immediate right of the divergence point of the A6 left junction form a site important in some step in the transfer of T-region DNA from the bacteria to the plant is discussed.
Nucleic Acids ResearchCharacterization of the<i>virE</i>operon of the<i>Agrobacterium</i>Ti plasmid pTiA6
66 Citations1987Stephen C. Winans, Paul Allenza +3 more
Analysis of codon usage of virE and seven other vir loci indicates that, in contrast to E. coli, all possible codons for a given amino acid are utilized at approximately the same frequency.
ScienceTransfer of <i>Agrobacterium</i> DNA to Plants Requires a T-DNA Border But Not the <i>vir</i> E Locus
55 Citations1986Richard C. Gardner, Vic Knauf
Agrobacterium strains were used to transfer complementary DNA copies of a potato spindle tuber viroid to plant cells at a wound site on tomato plant stems, indicating systemic PSTV infection.
Journal of Biological ChemistryDNA binding properties of the T4 DNA helix-destabilizing protein. A calorimetric study.
27 Citations1979Kenneth R. Williams, Laurel O. Sillerud +2 more